Mbascp - Study guides, Class notes & Summaries

MB ASCP CONNECT(edited version).What is translocation is associated with Burkitt's Lymphoma? a. t(18; 14) b. t(9; 22) c. t(8; 14) d. t(15; 17) ANSWER- t(8; 14) TIP: Burkkitt's 8 letters, Locus PF Child Paternity Index LOC-A1 3 2/3 2.18 LOC-B2 7/5 5 0.798 LOC-C3 17/17 9/17 5.21 LOC-D4 12 12 1.37 Based on the data presented in the table above and with a prior probability (PP) of 0.5, the probability of paternity in this case is : a. 92.5% b. 99.5% c. 90.5 & d. 95.5% AN...

MB ASCP Test Molecular Techniques (20-30%) 100% Correct Answers. What are the 3 types of gel electrophoresis -ANSWER Agarose Polyacrylamide Pulse Field What is gel electrophoresis -ANSWER the separation of materials based on size and migration patterns when subjected to electrical forces in a resistive medium. which direction does the DNA flow in gel electrophoresis -ANSWER due to DNA being negatively charged, it will migrate towards the positive end What determines how far the DNA w...

ASCP BOC EXAM Study GuideWhen using an electronic cell counter, which of the following results can occur in the presence of a cold agglutination? a) increased MCV and decreased RBC b) increased MCV and normal RBC c) decreased MCV and increased MCHC d) decreased MCV and RBC - ANSWERa) increased MCV and decreased RBC Cerebrospinal fluid for glucose assay should be: a) refrigerated b) analyzed immediately c) heated to 56 degree C d) stored at room temp after centrifugation - ANSWERb) analyzed im...

Molecular Diagnostics Chapter 11 ORIGINAL VERSION. What are examples of PCR inhibitors? - ANSWERS.hemoglobin, acidic polysacharrides, nitrate, crystals, beta-human chorionic gonadatropin, heparin, lactoferrin, anticoagulants, sodium polyanethol sulfonate, and polyamines STAR - ANSWERS.stool transport and recovery buffer inactivates infectious organisms What is the purpose of a sensitivity control? - ANSWERS.shows lower limit of detection true negative - ANSWERS.Indicates accurately tha...

MB ASCP Ch 13 Molecular Detection of Inherited Diseases Estimatics En polymorphisms -ANSWER mutations useful for mapping, determining parentage balanced polymorphisms -ANSWER just a DNA sequence difference, the phenotypic effect of which is counteracted by a second trait or polymorphism methylation -ANSWER usually cytosine in CpG islands, shuts down RNA transcription by adding methyl groups genomic impringing -ANSWER enzymatic addition of methyl groups to specific nitrogen bases in a pr...

Molecular Diagnostics Chapter 13 Assessment.Oncogenes genes that cause cancer by blocking the normal controls on cell reproduction, oncogenes prevent apoptosis

Molecular Diagnostics Chapter 7(All Correct Answers Avaible)chromosome mutation - ANSWERS.change in chromosome structure Genome mutations - ANSWERS.changes in chromosome number Euploid - ANSWERS.an individual with How many base pairs are in the human genome? - ANSWERS.2.9 billion What is the difference between a mutation and a polymorphism? - ANSWERS.mutations are reserved for rare changes in DNA like those found in cancer. Polymorphisms are variants that occur in 1-2% of the population...

MB ASCP Chapter 1 Study Questions and Answers.What is the function of DNA in the cell - aANSWERCarry genetic information How do purines and pyrimidines - aANSWERPurines have double ring; pyrimidines have a single ring Write the complementary sequence for the following DNA sequence 5' AGGTCACGTCTAGCTAGCTAGA 3' - aANSWER5' AGGTCACGTCTAGCTAGCTAGA 3' Answer: 5' TCTAGCTAGCTAGACGTGACCT 3' Which of the ribose carbons participate in the phosphodiester bond - aANSWERThe 5' ribose carbon...

MB ASCP Demo Practice Exam Questions1. Given the anti-sense strand of DNA: 5'-AATTGCCGACATAGAT-3' which is the appropriate sense strand? A. 5'-ATCTATGTCGGCAATT-3' B. 5'-TTAACGGCTGTATCTA-3' C. 5'-AATTGCCGACATAGAT-3' D. 5'-GAGCACGCTATCTTAT-3' - ANSWERA. 5'-ATCTATGTCGGCAATT-3' 2. Consider the probe sequence, CTACCGTAATATTCGACCGT, to be used in a hybridization procedure. What is the melting temperature, Tm, of the sequence? A. 60°C B. 58°C C. 64°C D. 62°C - ANSWERB. 58°C ...