Mbascp - Study guides, Class notes & Summaries
Looking for the best study guides, study notes and summaries about Mbascp? On this page you'll find 39 study documents about Mbascp.
Page 4 out of 39 results
Sort by
-
MB ASCP CONNECT(edited version).
- Exam (elaborations) • 38 pages • 2023
-
- $11.49
- + learn more
MB ASCP CONNECT(edited version).What is translocation is associated with Burkitt's Lymphoma? 
 
a. t(18; 14) 
b. t(9; 22) 
c. t(8; 14) 
d. t(15; 17) ANSWER- t(8; 14) 
 
TIP: Burkkitt's 8 letters, 
 
Locus PF Child Paternity Index 
 
LOC-A1 3 2/3 2.18 
LOC-B2 7/5 5 0.798 
LOC-C3 17/17 9/17 5.21 
LOC-D4 12 12 1.37 
 
Based on the data presented in the table above and with a prior probability (PP) of 0.5, the probability of paternity in this case is : 
 
a. 92.5% 
b. 99.5% 
c. 90.5 & 
d. 95.5% AN...
-
MB ASCP Test Molecular Techniques (20-30%) 100% Correct Answers.
- Exam (elaborations) • 12 pages • 2023
-
- $10.49
- + learn more
MB ASCP Test Molecular Techniques (20-30%) 100% Correct Answers. 
What are the 3 types of gel electrophoresis -ANSWER Agarose 
Polyacrylamide 
Pulse Field 
 
What is gel electrophoresis -ANSWER the separation of materials based on size and migration patterns when subjected to electrical forces in a resistive medium. 
 
which direction does the DNA flow in gel electrophoresis -ANSWER due to DNA being negatively charged, it will migrate towards the positive end 
 
What determines how far the DNA w...
-
ASCP BOC EXAM Study Guide
- Exam (elaborations) • 11 pages • 2023
-
- $10.49
- + learn more
ASCP BOC EXAM Study GuideWhen using an electronic cell counter, which of the following results can occur in the presence of a cold agglutination? a) increased MCV and decreased RBC b) increased MCV and normal RBC c) decreased MCV and increased MCHC d) decreased MCV and RBC - ANSWERa) increased MCV and decreased RBC 
 
Cerebrospinal fluid for glucose assay should be: a) refrigerated b) analyzed immediately c) heated to 56 degree C d) stored at room temp after centrifugation - ANSWERb) analyzed im...
-
Molecular Diagnostics Chapter 11 ORIGINAL VERSION.
- Exam (elaborations) • 5 pages • 2023
-
Available in package deal
-
- $8.99
- + learn more
Molecular Diagnostics Chapter 11 ORIGINAL VERSION. 
What are examples of PCR inhibitors? - ANSWERS.hemoglobin, acidic polysacharrides, nitrate, crystals, beta-human chorionic gonadatropin, heparin, lactoferrin, anticoagulants, sodium polyanethol sulfonate, and polyamines 
 
STAR - ANSWERS.stool transport and recovery buffer inactivates infectious organisms 
 
What is the purpose of a sensitivity control? - ANSWERS.shows lower limit of detection 
 
true negative - ANSWERS.Indicates accurately tha...
-
MB ASCP Ch 13 Molecular Detection of Inherited Diseases Estimatics Exam.
- Exam (elaborations) • 5 pages • 2023
-
- $9.49
- + learn more
MB ASCP Ch 13 Molecular Detection of Inherited Diseases Estimatics En polymorphisms -ANSWER mutations useful for mapping, determining parentage 
 
balanced polymorphisms -ANSWER just a DNA sequence difference, the phenotypic effect of which is counteracted by a second trait or polymorphism 
 
methylation -ANSWER usually cytosine in CpG islands, shuts down RNA transcription by adding methyl groups 
 
genomic impringing -ANSWER enzymatic addition of methyl groups to specific nitrogen bases in a pr...
Too much month left at the end of the money?
-
Molecular Diagnostics Chapter 13 Assessment.
- Exam (elaborations) • 6 pages • 2023
-
Available in package deal
-
- $10.99
- + learn more
Molecular Diagnostics Chapter 13 Assessment.Oncogenes 
genes that cause cancer by blocking the normal controls on cell reproduction, oncogenes prevent apoptosis
-
Molecular Diagnostics Chapter 7(All Correct Answers Avaible).
- Exam (elaborations) • 5 pages • 2023
-
Available in package deal
-
- $9.99
- + learn more
Molecular Diagnostics Chapter 7(All Correct Answers Avaible)chromosome mutation - ANSWERS.change in chromosome structure 
 
Genome mutations - ANSWERS.changes in chromosome number 
 
Euploid - ANSWERS.an individual with How many base pairs are in the human genome? - ANSWERS.2.9 billion 
 
What is the difference between a mutation and a polymorphism? - ANSWERS.mutations are reserved for rare changes in DNA like those found in cancer. Polymorphisms are variants that occur in 1-2% of the population...
-
MB ASCP Chapter 1 Study Questions and Answers.
- Exam (elaborations) • 3 pages • 2023
-
- $8.99
- + learn more
MB ASCP Chapter 1 Study Questions and Answers.What is the function of DNA in the cell - aANSWERCarry genetic information 
 
How do purines and pyrimidines - aANSWERPurines have double ring; pyrimidines have a single ring 
 
Write the complementary sequence for the following DNA sequence 
5' AGGTCACGTCTAGCTAGCTAGA 3' - aANSWER5' AGGTCACGTCTAGCTAGCTAGA 3' 
Answer: 5' TCTAGCTAGCTAGACGTGACCT 3' 
 
Which of the ribose carbons participate in the phosphodiester bond - aANSWERThe 5' ribose carbon...
-
MB ASCP Demo Practice Exam Questions
- Exam (elaborations) • 2 pages • 2023
-
- $7.99
- + learn more
MB ASCP Demo Practice Exam Questions1. Given the anti-sense strand of DNA: 5'-AATTGCCGACATAGAT-3' which is the appropriate sense strand? 
A. 5'-ATCTATGTCGGCAATT-3' 
B. 5'-TTAACGGCTGTATCTA-3' 
C. 5'-AATTGCCGACATAGAT-3' 
D. 5'-GAGCACGCTATCTTAT-3' - ANSWERA. 5'-ATCTATGTCGGCAATT-3' 
 
2. Consider the probe sequence, CTACCGTAATATTCGACCGT, to be used in a hybridization procedure. What is the melting temperature, Tm, of the sequence? 
A. 60°C 
B. 58°C 
C. 64°C 
D. 62°C - ANSWERB. 58°C ...
$6.50 for your textbook summary multiplied by 100 fellow students... Do the math: that's a lot of money! Don't be a thief of your own wallet and start uploading yours now. Discover all about earning on Stuvia